Eduardo Fermino Carlos - Florida Citrus Mutual
Transcrição
Eduardo Fermino Carlos - Florida Citrus Mutual
Eduardo Fermino Carlos scientific researcher, http://www.centrodecitricultura.br/ Cordeirópolis, SP, Brazil [email protected] Cambuhy Farm, Jan 2005 Tree 1 Tree 2 Tree 3 sample 140) No symptoms (ns) sample 141) initial vein clearing (ivc) sample 146) leaf mottle (lm) sample 142) initial mottling (im) lm ns ivc M H P N 140 141 142 146 im Primers: Colleta-Filho et al, 2005 Cambuhy Farm, Jan 2005 nfa fa Tree 2 Tree 1 Leaves: PCR + Leaves: PCR - sample 141) initial vein clearing (ivc) sample 140) No symptoms (ns) sample 142) initial mottling (im) Fruits: fluorescent albedo (fa) under UV light VAN VUUREN (South Africa) Fruits: non-flourescente albedo (nfa) Normative Law number 10, March 18th 2005 (2006; 2008?), “Greening Task Force”: Fundecitrus / Grower (2006) 1) Inspection 3) Help 2) Tagging trees CDA Sampling Centro APTA Citros Sylvio Moreira analysis, diagnosis, official reports Grower CDA notification 4) Block erradication (2008?) 4) Corrections In 2005: ¾ Higher ¾ Only risk in ~ 80 million trees !!! for diagnostic ? • ~ US$ 10.00 / PCR reaction • Total cost of near US$ 800,000,000.00 (above millions !!! ) ¾ Difficulties to recognize the symptoms Research actions How to have a large scale reliable diagnosis ? ¾ Phloem bacterium ¾ Low concentration ¾ Not cultured yet ! Agrindus Farm, March 2005 A B B A C C D D P N P P H2O A B C D Natal/Swingle Jan to Mar of 2005, Dissecting trees: A) Yellow shoot C) Blotchy mottle tree 1 tree 2 P A B C D E A B C DE B) Blotchy mottle tree 4 PA B C DE tree 5 A B C DE tree 6 A B C DE D) nonsymptomatic E) Roots fotos: E.F.Carlos Very didactical in 2005: Blotchy mottled leaf Asymetrical chlorosis “pen method” fotos: E.F.Carlos Foto: E.F.Carlos Training scouts for Fundecitrus and CDA (2005) Efficiency of HLB diagnosis Samples (trees) processed at the Sylvio Moreira Citrus Center Fundecitrus transition Samples for HLB New law % Negatives % Positives Jul Aug Sep Oct Nov De Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov De Jan Feb Mar Apr May Jun Jul Aug Sep 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 2005 2006 2007 the disease! HLB (‘yellow shots’) Not marketable Fruit drop (‘greening’) Diaphorina citri (Pedro Yamamoto) Fotos: E.F.Carlos Diagnóstico de HLB (Huanglongbing), ou Greening Amostras processadas no Centro APTA Citros Sylvio Moreira Ano mes Positivas Negativas Total %Positivas Total 2005: 131,425 20,242 151,667 86.7 Total 2006 258,343 16,456 274,799 94.0 Total 2007 24,138 858 24,996 96.6 929 28 957 97.1 Fevereiro 2,975 16 2,991 99.5 Março 5,090 15 5,105 99.7 Abril 19,996 69 20,065 99.7 Maio 12,737 20 12,757 99.8 Junho 11,364 36 11,400 99.7 Julho 17,596 30 17,626 99.8 Parcial 2008 70,687 214 70,901 99.7 Total geral: 484,593 37,770 522,363 92.8 Janeiro PCR quantitativo de Tempo Real f (PCR) = 2*c (até fase linear) A B ∆Ct = CtA – CtB Log (quantificação) DesPad CV% Produto menor, mais eficiente Novais, C.M., Pires-Alves, M., Silva, F.F. PCR em tempo real. Revista Biotecnologia Ciência & Desenvolvimento, n.33, julho/dezembro, p.10-13, 2004. Estratégia para Liberibacters em São Paulo (2006) Taqman probes: Ca. L. asiaticus Ca L. asiaticus - AB008366 Ca L. asiaticus – São Paulo Ca L. variante LSg2 101 150 AAAGTACCCAACATCTAGGTAAAAACCTAAACTTGATGGCAACTAGAGGC AAAGTACCCAACATCTAGGTAAAAACCTAAACTTGATGGCAACTAGAGGC AAAGTTCCCAAC--------------TTAA---TGATGGCAAATATAGGC ***** ****** *** ********* ** **** Ca. L. americanus Variantes de Liberibacter: Texeira et al (Plant Disease, v.89: 107, 2005) Colleta-Filho et al (Plant Disease, v.89: 848, 2005) Dragão amarelo A Clorose assimétrica BeC Sem sintoma D Experimento: -5 plantas -2 reações/amostra -reações duplex (18S+Ca.L.am.) Carlos, et al, 2006) Sonda: 18S Sonda: Ca. L. americanus Plantas com ~ 6 anos A B C C) Clorose assimétrica B) Clorose assimétrica D D) sem sintomas A) Dragão amarelo ∆Ct = CtD – CtABC = 42 – 31 = 11 ciclos: Detecção em folhas sem sintomas ABC > D 2*11 = 2048 x Different to CVC Pruning does not work with HLB foto: E.F.Carlos HLB effect Losses caused by HLB in São Paulo ¾ ¾ ¾ Officially: 484,593 (aug, 2008) Volunteered: ~ 2.5 million trees removed Total, around 3 million trees lost Is that “impactant”? ¾ ¾ ¾ ¾ Actual belt with ~ 200 million trees So, around 1.5% lost in 4 years Regular grove renew of 6 to 8% per year New citrus area in the Southwestern SP HLB em SP Araraquara 2004 HLB em SP Cafelândia Santa Cruz do Rio Pardo Itatinga 2004 2005 HLB em SP Viradouro Júlio Mesquita Espírito Santo do Pinhal Campos Novos Paulista Cesário Lange 2004 2005 2006 Patrocínio Paulista Pedranópolis Capão Bonito 2004 2005 2006 2007 2008 Casos aguardando confirmação HLB em SP 2004 2005 2006 2007 2008 Municipalities Araraquara São Carlos Brotas Sta. Rita do Passa Quatro Matão Descalvado Boa Esperança do Sul Others Total % Total 32.7 10.0 6.8 6.3 6.2 5.7 3.9 28.5 100.0 In HLB restraining effort: time is the most precious factor HLB = time Muito obrigado, Eduardo Fermino Carlos [email protected]